Szukaj

Stephen C. Meyer, DNA a pochodzenie życia. Informacja, specyfikacja i wyjaśnienie

Powrót do wszystkich dyskusji

Dyskutowany tekst


Data wysłania: 2007-08-09 09:29:22

Tytuł: Założenie
Liczenie prawdopodobieństw dotyczy tylko takiego życia, jakie znamy. Nic nie wiemy, czy jest to jedynie możliwe - a to siłą rzeczy autor zakłada. Nienowa jest myśl, że przyroda ewoluuje do życia w bardzo różnych formach. Wówczas całe rozumowanie w artykule jest mocno uproszczone.

Autor: KingKong
Data wysłania: 2007-08-19 17:36:40

Tytuł: "Logika" światopoglądu "naukowego".
Dawkins w swojej książce "Rzeka genów" Puszczając wodze wyobrazni napisał pewną ciekawą historyjkę,która zarazem świadczy o jego uczciwości intelektualnej (str. 37-38). Bohaterem jego opowiadania jest fikcyjny profesor, który uwięziony przez wrogie mocarstwo jest zmuszany do pracy nad bronią masowej zagłady. Postanawia ostrzec ludzi i drogą inżynierii genetycznej zapisuje w DNA wirusa grypy ostrzeżenie dla reszty ludzkości. Pózniej zaraża się tym wirusem, kicha na naradzie naukowej, dalej ktoś zarażony w kicha porcie lotniczym i tak świat zaraża sie ostrzeżeniem o niebezpieczeństwie.

Dawkins pisze,że ilość trypletów pozwala na określenie liter alfabetu angielskiego, z uwzględnieniem wielkich liter i znaku kropki.

Naukowcy zaczynają badać nowy szczep wirusa i dostrzegają osobliwy (nie mogący kodować żadnego ze znanych białek w wirusie grypy) ciąg DNA.
I TUTAJ UWAGA: Dawkins pisze:

"ktoś zauważa sekwencję złożoną z następujących po sobie cyfr KTÓRA W ŻADEN SPOSÓB NIE MÓGŁA POWSTAĆ SPONTANICZNIE, BEZ INGERENCJI CZŁOWIEKA"

Człowieka, a zarazem inteligencji oczywiście!

Nie przeszkadza to jednak Dawkinsowi przyjąć bez zmrużenia oka ,że niezwykle skomplikowane sekwencje w DNA ,które umożliwiają zakodowanie poplipeptydów, takich jak enzymy, które z reguły składają się ze 100 aminokwasów tj. 300 nukleotydów w ściśle uporządkowanej sekwencji, powstały spontanicznie :)

Ciekawe. jak Dawkins odróżnia informację inteligentną od informacji nieinteligentnej i jedną przypisuje inteligencji,a drugą (bardziej inteligentną) ślepym siłom natury?:). Przeciez rozszyfrowaliśmy kod genetyczny i widzimy wyraznie logikę, jaką on niesie, więc dlaczego ślepy Dawkins przypisuje ją przypadkowemu powstaniu?

A jakie jest tego prawdopodobieństwo, o tym pisał już Hoyle i nic dziwnego, że Dawkins tak bezowocnie produkował sie i w innej swojej książce ("Wspinaczka na szczyt nieprawdopodobieństwa"), żeby obalić rozumowanie Hoyle'a . Wyglądały owe zabiegi bardzo komicznie, poniewaz z jednej strony znamionowała Dawkinsa impotencja intelektualna, a z drugiej
strony nie wypadało mu - z braku argumentów - zmieszać z błotem szlachcica i uczonego tej miary co Fred Hoyle.

Sile mojej argumentacji dodaje fakt, iż Dawkins przyznał w swojej książce "Ślepy zegarmistrz", że maszyneria transkrypcyjno-translacyjna ma wszelkie cechy układu inteligentnie zaprojektowanego. Oczywiście zaznaczył, iż przyjęcie naturalnego wniosku o inteligentnym zaprojektowaniu takiej maszynerii stoi w sprzeczności ze światopoglądem naukowym, którego przeświadczeniem jest, iż ta skomplikowana maszyneria transkrypcyjno-translacyjna, która ma wszelkie cechy układu zaprojektowanego przez inteligencje, musiała jakoś powstac sama:).

pozdrawiam.

Autor: KingKong
Data wysłania: 2007-08-19 18:03:49

Tytuł: Jakie geny regulują geny regulatorowe?
I znowu Dawkins nazwał ten dylemat w rodzaju kura czy jajo. Ale zraz potem podał swoją hipotezę. Napisał, że działa to jak w komputerze program do ładowania innych programów. Oczywiście, nie wyjaśnił, skąd wziął się ten pierwszy program nadzorujący dalsze działanie genów, ale - jak to Dawkins - zwrócił uwagę na ciekawą rzecz. Otóż popularnonaukowo opisał proces rozwoju z zygoty, która jest podzielona na "segmenty", na podstawie tych biegunów rozwijają się poszczególne typy komórek. Szczegółowo idzie o to, że zanim komórka podczas brocesu embriogenezy podzieli się, ma już w tych biegunach mRNA, nagromadzone w formie informosomów i odpowiedzialne za
powstawanie odpowiednich białek regulatorowych. Jak zachodzi regulacja powstawania tych transkryptów póki co Bóg jeden wie, ja myślę, że poprzez jakieś proste induktory chemiczne obecne w środowisku, w jakim rozwija się zarodek. Tę całą tajemnicę rozwiązuje przyjęcie do wiadomości, że pierwsze żywe organizmy zostały stworzone od razu z genami regulacyjnymi i odpowiednimi im środowiskami. Nawet ten "program załadowujący" inne geny musiał mieć swoje pochodzenie. Tak czy nie?

Ewolucjoniści/ateiści już od samego początku swojego przegranego mitu postulują ,że ogromna informacja i jej obsługa (kura i jajko) powstały równocześnie i w sposób spontaniczny. Idzie oczywiście o abiogenezę. Nigdy tego nie udowodnili, a nawet nie zaprezentowali możliwego do przyjęcia modelu teoretycznego tej ewolucji chemicznej. Świadczy to ewidentnie, iż butni i zarozumiali ewolucjoniści/ateiści nie wspięli się nawet na pierwszy szczebel swojego mitu o ewolucji.

pozdrawiam.

Autor: KingKong
Data wysłania: 2007-08-19 18:36:57

Tytuł: Odpowiedz P.Mierzejewskiemu.
>Liczenie prawdopodobieństw dotyczy tylko takiego życia, jakie znamy. Nic
>nie wiemy, czy jest to jedynie możliwe - a to siłą rzeczy autor zakłada.
>Nienowa jest myśl, że przyroda ewoluuje do życia w bardzo różnych
>formach. Wówczas całe rozumowanie w artykule jest mocno uproszczone.

Oczywiście, Pańska argumentacja miała by jakieś poparcie faktograficzne, gdyby Pan był łaskaw podać jakiś przykład (choćby teoretyczny) nieznanego życia, do którego wyliczenia owe nie miałyby praktycznego zastosowania. Póki co Pan i Panu podobni erystyczni gawędziarze poruszacie sie w sferze imaginacji, która w żaden sposób do szablonów nauki nie przystaje.

pozdrawiam.

Autor: KingKong
Data wysłania: 2007-08-27 20:30:15

Tytuł: Co mówi nam genomika?
Co tak naprawdę genomika mówi nam o ewolucji? Czy genomika potwierdza Syntetyczną Teorię Ewolucji?
Dla niewtajemniczonych: genomika zajmuje się porównywaniem struktury i funkcji genów, analizą pokrewieństwa między taksonami i śledzeniem mechanizmów jej ewolucji. Genomika porównawcza pozwala ustalić homologie genetyczne (paralogiczne i ortologiczne). Genomika ma na usługach STE powinna szukać powiązań między genami, rekonstruować wydarzenia ewolucyjne itd.

PROKARIONTY:

Nauka poznała już genomy kilkudziesięciu gatunków bakterii. Organizacja genomów bakteryjnych i zawartych w nich genów okazała się niezwykle różnorodna. Naukowcy poczuli się zaskoczeni :) Ponadto okazało się, że nauce nieznana jest funkcja ponad połowy znalezionych u bakterii potencjalnych genów (ORF)! Fakt ów dotyczy nawet rzekomo dobrze poznanej pałeczki okrężnicy.

EUKARIONTY:

Co pokazują dane zaobserwowane u prokariontów? Ano to, że geny w organizmach eukariotycznych są zorganizowane hierarchicznie w rodziny i nadrodziny genów. Wyciągnięto z tego daleko idący i nieuprawniony wniosek, że ta hierarchia jest spowodowana licznymi duplikacjami i dalszą dywergencją genów oraz tasowaniem egzonów. Oczywiście, jak w przypadku homologii morfologicznych, które Darwin uznał za dowód wspólnego pochodzenia, podobieństwa w budowie genów można interpretować jako dowód wspólnego planu realizowanego przez tego samego autora. Poza tym biorąc pod uwagę katalityczne możliwości enzymów (ich centra aktywne) oraz morfologie enzymów i białek strukturalnych, które wprowadzają wewnątrz tych białek różnice, świat tych cząsteczek okazuje się niewyobrażalnie złożony i zadziwiający.

Dzisiaj naukowcy zrobili kompletną sekwencje już kilku kompletnych genomów eukariotycznych. Oczywiście, w porównaniu z oszałamiającą złożonością świata żywego, biorąc pod uwagę występującą liczbę istniejących gatunków eukariotycznych, korzystając z tych niekompletnych danych, można wyciągnąc interesujące wnioski.

SSAKI:
Okazuje się, że organizacja genomu ssaków jest niezwykle konserwatywna ewolucyjnie - taki wniosek i sformułowanie to, oczywiście, wniosek i sformułowanie ewolucjonistów. Ja używam ich tylko dla wygody. Co to znaczy, że coś jest "konserwatywne ewolucyjnie"? Znaczy to tyle, iż "konserwatywny ewolucyjnie gen (czy cały organizm) nie ewoluował przez miliony, a nawet dziesiątki milionów lat!
Przypominam, iż według ewolucjonistów struktura hierarchiczna w genomach też jest "konserwatywna ewolucyjnie". Czy to mysz, szczur, szympans czy człowiek, mimo licznych abberacji w chromosomach (zmiany np. translokacje, które maja mieć istotne znaczenie w powstawaniu i organizacji genomów), powszechnie występują u tych gatunków rejony synteniczne (długie odcinki zawierające taki sam układ genów). Jest to tak powszechne zjawisko, że na podstawie takich układów można przewidywać lokalizacje konkretnego ortologa (geny homologiczne) występujące u różnych organizmów) u jakiegoś gatunku na podstawie lokalizacji ortologa u innego gatunku.
Nawet u (według ewolucjonistów) odległych ewolucyjnie gatunków, jak ryba pewien gatunek ryby i człowieka wykazano w ich chromosomach duże bloki synteniczne (oczywiście, nie nalezy rozumieć, iż te różne organizmy mają podobne kariotypy. Porządek tych ortologów był zakłócony przez odwrócenie kolejności lub przemieszanie-dodatkowy argument o ich nieewolucyjnym pochodzeniu).
Ewolucjoniści twierdzą, iż z punktu widzenia STE świadczy to o przegrupowywaniu w toku ewolucji genów w obrębie chromosomów, jaki to proces niby jest częstszy niż translokacje. Oczywiście, nie poparto takiego neodarwinowskiego procesu żadnym konkretnym przykładem.

Wróćmy raz jeszcze do owej "konserwatywności". Z tego, co odkryto, badając genomy róznych taksonów (tych rzekomo ewolucyjnie mniej i bardziej zaawansowanych), wynika, że naprawdę nic się w tych genomach (poza ilościowymi zmianami, którymi chce się uzasadnić mechanizmy ewolucji)istotnego nie zdarzyło. Jak postulują ewolucjoniści, wspólny przodek myszy i człowieka żył 70.000.000 lat temu. No i co tak naprawdę zmieniło się w jakości mysich i ludzkich genomów/genów przez ten czas ewolucji? Ponieważ czy to genomy mysie, szympansie, czy ludzkie, to ich hierarchia budowy nic nam o ich ewolucji nie mówi!
Powyższe fakty właśnie zmusiły zasiedziały, butny i zbyt pewny siebie neodarwinizm do zmian. Na razie pisze się o tym po łebkach, ale już niedługo nastąpi istna rewolucja. Kiedyś wyszydzany profesor Maciej Giertych przepowiedział tę rewolucję. Przepowiedział, że czeka ona całe współczesne pokolenie biologów. Oto słowa profesora Giertycha materializują się nam na naszych oczach i za jego życia!
Wprowadza się obecnie do biologii bliżej niesprecyzowana hipotezę ewolucyjnych zmian w sekwencjach regulatorowych. To zwykłe zamydlanie oczu krytyce, ponieważ naprawdę wiemy bardzo mało o genach regulatorowych, hierarchii ich ekspresji, no i w końcu to, co reguluje geny regulatorowe pozostaje tajemnicą (tak więc mamy tu dylemat w rodzaju "kura czy jajko":))

Teraz napiszę kilka słów, a zarazem niewyjasnionych zagadek (oprócz tej w rodzaju "kura czy jajko") w temacie regulacji genetycznej Czy jakikolwiek laik zdaje sobie sprawę, że sekwencje regulatorowe w genach kodujących rRNA (rybosomowe RNA) nie wykazuje homologii pomiędzy różnymi grupami eukariontów?

A jakie jest tłumaczenie tej anomalii przez samych ewolucjonistów? "Ewolucja tych sekwencji w obrębie różnych grup eukariontów musiała być skoordynowana". Skoordynowana - mawiają, a jaką owe stwierdzenie ma wartość poznawczą? A taką, że dobór naturalny faworyzował takie a takie sekwencje, że ulegały pozytywnej selekcji. Czyli zwykłe i intelektualnie puste gołosłowie (takie sobie bajeczki).
Powyższy fakt wydaje się bardzo dziwny w świetle tego, iż odcinki regulatorowe kodujące mRNA są już według ewolucjonistów (nie wiadomo - jak w poprzednim wypadku) "konserwatywne ewolucyjnie".

Ale czy same zmiany w opisanych przeze mnie sekwencjach regulatorowych w obrębie promotorów i innych sekwencji wyjaśniaja ewolucje biologiczną? Odpowiedz brzmi NIE!

Naukowcy zajmujacy się tworzeniem zwierząt transgenicznych przypadkiem trafili na ciekawy fakt. Gen hormonu wzrostu połączono z promotorem genu kodującego metalotineinę. Zabieg ten wywołał wysoki wskaznik ekspresji tego genu u transgenicznej myszy nie tylko w wątrobie, gdzie normalnie gen ten ulega ekspresji, ale także w pewnych wydzielonych obszarach mózgu!

Ten eksperyment odsłania skomplikowane zależności pomiędzy różnymi genami w procesie ich regulacji. Zakłócenie spowodowane owym eksperymentem zaburzyło jakieś biościeżki i spowodowało sztuczną plejotropie hormonu wzrostu. Czy wyobrażamy sobie, do jakich katastrof mogłyby doprowadzać zmiany w systemie regulacji genów? Czy wyobrażamy sobie, co by się stało, gdyby enzymy proteolityczne biorące udział w żołądkowym trawieniu zaczęły ujawniać swoją ekspresje w mózgu?
Scenariusze takich katastrof można mnożyć, dla nas najistotniejsze jest jednak ,że przy obecnym stanie wiedzy i sytuacji, jaka zapanowała w biologii ewolucyjnej, neodarwiniści nie maja nam nic do zaoferowania. Nie maja w swoim posiadaniu żadnego wiarygodnego mechanizmu, jaki mógł spowodować bezbożną ewolucję :)

Na koniec napiszę coś o zmianach robertsonowskich - takich jak fuzje chromosomów. Oczywiście i być może taka fuzja zaszła u człowieka (przecież zaszła też w obrębie rodziny koni). No i co z tego? Jaki to dowód na ewolucję?
Czy ewolucjoniści potrafią pokazać korzyści ewolucyjne płynące z takich fuzji?
Mutacja, jak mutacja i nic więcej.

No i jeszcze krótko o poliploidalności. Mawia się, że poliploidalność dużo wniosła do ewolucji roślin. A jednak uważa się, że ryby łososiowate powstały wskutek autotetraploidyzacji już około 100.000.000 lat temu. Mimo to jednak ich chromosomy dalej koniugują po cztery i zduplikowane geny nie ulegają dywergencji.

Więc, jak widzimy, naprawdę, genomika nie dostarcza nam żadnych jednoznacznych dowodów na ewolucję. A wręcz przeciwnie.

Autor: KK
Data wysłania: 2007-08-28 06:58:30

Tytuł: Dodatek
Jak postulują ewolucjoniści, wspólny przodek myszy i człowieka żył 70.000.000 lat temu. No i co naprawdę zmieniło się w jakości mysich i ludzkich genomów/genów przez ten czas ewolucji? Ponieważ czy to genomy mysie, szympansie, czy ludzkie, to ich hierarchia budowy nic nam o ich ewolucji nie mówi!

*Mimo trzydziestoprocentowych różnic geny myszy są na tyle homologiczne
do genów ludzkich, iż owe trzydziestoprocentowe różnice nie wyrażają różnic
morfologicznych (fenotypowych) pomiędzy człowiekiem a myszą. Skoro, według założeń ewolucjonistów, mysz jak i człowiek odziedziczyli jakiś
tam procent informacji genetycznej (nie wiem, jak to się szacuje w przypadku genomów. Wiem, że w przypadku przypadku mutacji (homologicznych w sekwencjach ortologicznych) niektórych genów rozkład ten jest szacowany 50%/50%. 50% po wspólnym przodku, 50% podczas dalszej,własnej ewolucji), to tak w rzeczywistości nie spadło daleko jabłko od jabłoni. Odchodzenie od ortodoksyjnych poglądów neodarwinowskich jest m.in. determinowane tym, iż różne "odległe ewolucyjnie" gatunki, tak różne fenotypowo, jak np. mysz-człowiek, człowiek-szympans mają tak podobne geny, jest ZADZIWIAJACE, wręcz SZOKUJACE!

Poza tym skoro się w biologii ewolucyjnej przyjmuje, że np. wspólny przodek
drożdży i człowieka był niewątpliwie bardziej podobny do drożdży niż człowieka, to mysz tez musiałaby być bardziej podobna do wspólnego i wyimaginowanego przodka z człowiekiem, niż człowiek. I gdzie tu tu widać postęp ewolucyjny?

Autor: KingKong
Data wysłania: 2007-09-13 17:17:50

Tytuł: Drugie prawo termodynamiki kontra abiogeneza.
Drugie prawo termodynamiki nie ma nic wspólnego z problemem powstania życia. Tutaj muszą być spełnione różne, koniecznie wymagane warunki biochemiczne. Aminokwasy muszą potrafić łączyć się w dłuższe polipeptydy spontanicznie i w odpowiedznim środowisku katalitycznym:

- Nie potrafią tego, co pokazują doświadczenia (z dużą pomocą człowieka powstają in vitro jedynie krótkie peptydy). Do tego potrzebne są rybosomy (translacja).

- Muszą potrafić łączyć się w odpowiedniej kolejności, a nie w jakiekolwiek układy złożone (sekwencji).

Nawet jakby aminokwasy potrafiły organizować się samoistnie w większe łąńcuchy polipeptydowe, to w jaki sposób wyeliminować wszelkie szkodliwe L-aminokwasy, P-aminokwasy (które doprowadzają po włączeniu do destrukcji w funkcjonalnym polipeptydzie z jego denaturacją włącznie - stwierdzone doświadczalnie!),a wyselekcjonować w racemacie tylko 20 tych potrzebnych L-aminokwasów i ułożyć je w odpowiedniej sekwencji, któraby pozwalała na ich funkcjonalność gourl.org/ex5 ?

Jakiś naturalistyczny cud musiałby spowodować wielokrotne i w jednym czasie i miejscu powstanie różnych funkcjonalnych enzymów, w obrębie jakiejś błony, i równoczesne powstanie w tym samym czasie i miejscu adekwatnego kodu genetycznego.

Te same problemy dotyczą powstania kodu genetycznego. Dłuższe łańcuchy polinukleotydowe czy polirybonukleotydowe powstają tylko w specjalnych warunkach, jakie panują w żywych organizmach. W warunkach in vitro powstają jedynie króciutkie sekwencje-losowe-na specjalnych preparatach, umożliwiających ich katalize. Teoretrycznie w hipotetycznym ryboracemacie do powstania funkcjonalnych łańcuchów polirybonukleotydowych musiałyby być spełnione analogiczne warunki, jak podczas powstawania funkcjonalnych polipeptydów w racemacie. Do powstania funkcjonalnych polipeptydów potrzebna jest złożona matryca mRNA, a do powstania tej matrycy złożona matryca DNA i złożone białka powstające na bazie tych matrycy. A więc dylemat w rodzaju kura czy jajo… gourl.org/ex6 ?

Zywa komórka to twór nieredukowalnie złożony, są granice jej redundancji. Żeby dobrze funkcjonowała taka transkrypcyjno-translacyjna maszyneria biochemiczna, musi istnieć odpowiednia maszyneria transkrypcyjno-translacyjna. Jeśli ktoś zna jakiś inny model żywego organizmu, który mógłby być protobiontem, to niech go opisze w formie eksperymentu myślowego.

Szymborski kiedyś napisał, iż wszelkie wyjaśnienia dotyczące powstania życia na drodze ewolucji chemicznej zamykają się w gołosłownym stwierdzeniu: życie powstało stopniowo.

pozdr.

Autor: miras
Data wysłania: 2007-09-28 14:26:12

Tytuł: odp. p.Mierzejewskiemu.
Panie Mierzejewski, a jakie Pan zna inne życie?

zp

Autor: miras
Data wysłania: 2007-09-28 14:29:28

Tytuł: Odp.p.King Kongowi
Ciekawe, jak Dawkins odróżnia informację inteligentną od informacji nieinteligentnej i jedną przypisuje inteligencji,a drugą (bardziej inteligentną) ślepym siłom natury?:).

miras:
Takie myślenie jest derminowane wymaganiami metodologii naukowej (nie wnikam, czy słusznej), a więc oparte o filozofię, a nie ustalone fakty empiryczne.

zp

Autor: KingKong
Data wysłania: 2007-09-28 17:06:06

Tytuł: Do Pana Mirosława.
Rachunek jest prosty: istnieje 100 rodzajów aminokwasów; połowa Lewych (lewoskrętnych), połowa Prawych (prawoskrętnych). Do powstania życia potrzebnych jest tylko 20 ściśle określonych rodzajów lewoskrętnych.
PRZEPROWADZMY EKSPERYMENT:
Wezmy kopiec kulek w kolorach czerwonym i białym, gdzie ów kopiec składa się ze stu rodzajów kulek o różnych kolorach (50 jest białych i 50 czerwonych) i rozmiarach (kopiec przedstawia racemat). Wrzućmy je do maszyny losującej i pojedynczo wylosujmy tylko 20 czerwonych kulek i to o ściśle wyznaczonych rozmiarach i kolejności. Powiedzmy,że potrzebujemy 100 takich kulek. Jakie jest prawdopodobieństwo ich wylosowania?

1-2-3-4-5-6-7-8-9-10-11-12-13-14-15-16-17-18-19-20-21-22-23-24-25-26-
27-28-29-20-31-32-33-34-35-36-37-38-39-40-41-42-43-44-45-46-47-48-49-
50-51-52-53-54-55-56-57-58-59-60-61-62-63-64-65-66-67-68-69-70-71-72-
73-74-75-76-77-78-79-80-81-82-83-84-85-86-87-88-89-90-91-92-93-94-95-
96-97-98-99-100

Oczywiście kulki białe i czerwone to analogie do Lewych i Prawych aminokwasów, rozmiary natomiast do ich różnych rodzajów (100). Proszę ocenić, czy można mieć jakieś uzasadnione pretensje do tego modelu? A przecież w rzeczywistości potrzebne są dłuższe ilości takich sznurów kulek ułożonych w ściśle określonej sekwencji/kolejności (analogia do potrzebnych w rzeczywistości dłuższych polipeptydów). Potrzeba kilkuset takich ściśle określonych "sznurów koralików" i to powstałych o właściwym czasie i miejscu. Można to sobie wyobrazić jako równoczesne losowanie kilkuset takich maszyn i za pierwszym razem trafienie właściwych wyników!

A co z kodem genetycznym? Czy to będzie DNA czy RNA, to przy założeniu, że pierwsze postulowane przez ewolucjonistów życie posługiwało się dzisiejszym kodem (jeden aminokwas kodowany przez trzy nukleotydy - nikt bardziej wiarygodnej opcji nie wymyślił ), przy odwołaniu się do naszego modelu, to taki kod dla jednego ze stukulkowego sznura koralików złożony musi być ze sznura 300 kuleczek, w którym owe kulki występują w czterech różnych kolorach, ułożone we właściwej sekwencji!

No i znowu możemy puśić w ruch naszą maszyne losującą, a właściwie równocześnie kilkaset takich maszyn i to równocześnie z tamtymi maszynami losującymi kulki przedstawiające aminokwasy!

Na koniec dodam małe uzupełnienie. Fred Hoyle przy swoich wyliczeniach prawdopodobieństwa powstania życia przyjął bardzo optymistyczne założenia. Otóż załozył wraz ze współpracownikiem, iż pierwotne polipeptydy tworzące enzymy były krótsze od współczesnych, no i mimo tych założeń wyszło im astronomiczne nieprawdopodobieństwo. Dzisiaj już wiemy (Hoyle pisał swoją książkę w latach osiemdziesiątych http://www.amazon.com/Evolution-Space-Theory-Cosmic-Creationism/dp/0671492632 ), że w żywych organizmach przeciętnie występują białka więcej niż 100-aminokwasowe, a więc istniejący dla nich kod genetyczny musi się sładać z więcej niż 300 nukleotydów (choć istnieją też geny strukturalne 300 nukleotydowe). Granica, do jakich schodzą polipeptydy, to coś około 70 aminokwasów, poniżej białka tracą swoją strukture przeszczenną i staja sie bezużyteczne. Żywy organizm,nawet ten najbardziej prymitywny, ale autonomiczny [który nie jest żadnym symbiontem zależnym od żywiciela http://www.biotechnolog.pl/news-422.htm ) musi się składać z kilkuset genów o różnej długości, nawet ponad 300 nukleotydów! Biorąc pod uwagę dodatkowe fakty, rodem z biochemii, okazuje się, iż spontanicznie, w warunkach symulujących pierwotną ziemię, nie powstają dłuższe peptydy, jak kilkuaminokwasowe i to w losowej sekwencji! To samo dotyczy łańcuchów polirybonukleotydowych i deoksyrybonukleotydowych!

Biorąc pod uwagę powyższe fakty można wyciągnąć tylko jeden wniosek: do powstania życia musiała się przyczynić inteligencja!

Nawet takie eksperymenty, jak te przeprowadzane przez Stanleya Millera, czy Szostaka nie podważają takiego stanowiska. Oto jak o takich eksperymentach wypowiedziała sie Lynn Margulis (profesor biologii):

"[Najmniejsza bakteria] o wiele bardziej przypomina ludzi niż mieszaninę związków chemicznych, otrzymaną przez Stanleya Millera, gdyż ma już owe właściwości [biochemicznego] systemu. Toteż mniejsza odległość dzieli bakterię od człowieka niż ową mieszaninę aminokwasów od bakterii"

pozdrawiam.

Autor: miras
Data wysłania: 2007-09-30 13:14:09

Tytuł: do P. KK
Jestem tego samego empirycznego poglądu co Pan. Mnie jednak chodziło o metodologie naukową. Nie chciałem (i nie mam zamiaru) wchodzić na tę drogę dyskusji, ponieważ nie mam zamiaru przechodzić takich kłopotów jak Pan z filozofami:)

zp

Autor: KK
Data wysłania: 2007-10-01 12:10:12

Tytuł: Do Pana Mirosława-poprawka.
Moim zdaniem krzywdzi Pan filozofów, wrzucając wszystkich do jednego worka. Istnieją przecież filozofowie - jak profesor Jodkowski - którzy znają granice swoich kompetencji i w sposób zgodny z wymogami uczciwości potrafią zaprezentować kontrowersje ewolucjonizm/kreacjonizm. Gorzej, kiedy dany filozof zaczyna zbaczać z drogi, jaką zakreśla mu jego własna specjalnośc i usiłuje się wypowiedać na tematy, które są dla niego w rzeczywistości wiedzą tajemną. Wówczas nie pozostaje takiemu nic innego, jak tylko tworzyć własną pseudofilozofię, za pomocą której da się uzasadnić każdą imaginację i koncepcję. Jeśli ktoś przy zastosowaniu takiej wolnej amerykanki zaczyna ze mną pogrywać, pozostaje mi tylko sprowadzić wszystko do dyskusji merytorycznej. :)

Autor: KK
Data wysłania: 2007-12-17 15:23:04

Tytuł: Kilka przepisów na powstanie życia:))
Najlepszy jest jeden z komentatorów, Stuart Kauffman. Jego zdaniem powstanie życia NIE JEST EFEKTEM przypadku, tylko samoorganizacji
materii. Ciekawe na czym polega ta "samoorganizacja materii", skoro nie na PRZYPADKU. Coraz bliżej Boga, panowie!

Robert Shapiro natomiast widzi jakieś prawa przyrodz, dzięki którym życie może powstawać samo. Ciekawe tylko, iż nigdy nie opisał tych praw w jakimś renomowanym czasopiśmie, za to creationism.org.pl/Members/admin/news/prostsze-poczatki-zycia jego zdaniem powstanie życia NIE JEST EFEKTEM przypadku, tylko samoorganizacji materii (pisałem więcej w poście o upadku hipotezy "świata RNA"..

www.newsweek.pl/artykuly/kategoria.asp?Kategoria=NAUKA

To dla przypadkowych czytelników, którzy od czasu do czasu mają w zwyczaju tu zaglądać, nie dla was stałych bywalców: ewolucjonistów/szarlatanów, więc proszę o powstrzymanie sie przez nich od komentarzy.

www.newsweek.pl/artykuly/kategoria.asp?Kategoria=NAUKA

"Francuski laureat Nobla, biolog Jacques Monod, pisał w 1970 roku: "Człowiek w końcu wie, że jest sam w nieczułym ogromie wszechświata, w którym pojawił się tylko przypadkiem". Ale już pokolenie synów i wnuków Monoda nie chce wierzyć w tę wyjątkowość i samotność. Belgijski biochemik Christian de Duve nazywa życie kosmicznym imperatywem i twierdzi, że jest ono "niemal zobowiązane, by się pojawić". - Życie jest wpisane w prawa natury - sądzi amerykański chemik Robert Shapiro, profesor New York University i autor ponad stu publikacji dotyczących DNA i życia poza Ziemią. - To samoorganizacja materii, a nie przypadek są źródłem życia - przekonuje Stuart Kauffman, profesor biochemii na Uniwersytecie Calgary. Takich badaczy jest coraz więcej. Wielu z nich jest także przekonanych, że w ciągu najbliższych kilkudziesięciu lat dowiemy się o istnieniu życia na innych ciałach niebieskich."

pozdrawiam.

Autor: KingKong
Data wysłania: 2007-12-20 12:11:47

Tytuł: Mały sprawdzian logiki ewolucjonistów:)
Jak można nie widzieć, że rozwój nauki coraz bardziej utwierdza nas
w przekonaniu o niemożliwości samoistnego powstania życia i dalej popychać
bzdurki, iż ten rozwój nauki doprowadzi w końcu do naturalistycznego wyjaśnienia fenomenu życia?

Autor: K/K
Data wysłania: 2007-12-28 02:29:52

Tytuł: Czy wszechświat nas się spodziewał?
Poniżej zaczerpnięta wypowiedź znanego uczonego z artykułu z ostatniego nru 'Swiata Nauki'. Otóż Davies w nim podkreśla, że z punktu widzenia ewolucjonistów powstanie życia stanowi ogromną tajemnicę, słowa te padają z ust znanego badacza zajmującego się tymi problemami i stanowią zaprzeczenie słow ewolucjonistów, powołujących się na jakieś rzekome prace wyjaśniające, a choćby rzucające światło na to zagadnienie:

http://www.swiatnauki.pl/swiat_nauki.php?id=8
"Geneza życia to jeden z największych nierozwiązanych problemów nauki. Nikt nie wie, jak, gdzie i kiedy powstało. Właściwie pewne jest tylko to, że trzy i pół miliarda lat temu na Ziemi istniały już mikroorganizmy. Na to, czy i co było wcześniej, brak mocnych dowodów. Jest więc dużo miejsca na polemiki."

Uświadomiwszy sobie nieprawdopodobieństwa przypadkowego zaistnienia życia, uczeni wysnuli hipoteżę głoszącą, że pojawienie się życia było w jakimś sensie koniecznościa we wszechświecie, w jakim żyjemy, że jest jego cechą (oczywiście darując sobie wyjaśnienie, jakie to prawa, obowiązujące w tym wszechświecie, doprowadziły do powstania życia). Jak widać, największą tajemnicę zastąpiono inną tajemnicą, sugerując pozorne wyjaśnienie. A nawet posunęli się do szaleństwa sugerując, że te niepoznane prawa wszechświata mogły doprowadzić do kilkakrotnego pojawienia się życia na ziemi i wszechświecie. Sugerują, że w naszym wszechświecie życie pojawia się łatwo i szybko, co jest sprzeczne z obserwacjami. Wszechświat, jaki widzą głosiciele tych teoryjek, po prostu nas się w jakiś sposób spodziewał. Poglądy te żywcem wynikają z zasady antropicznej. Więc mamy tu jakiś cel, sugerowane zamierzenie. Co dzień bliżej Boga!

Autor: King Kong
Data wysłania: 2008-09-11 10:31:32

Tytuł: Nowe teoryje wyruszają na podboje - pozorne postępy w abiogenetyce.
Uwaga, ja tu występuję pod pseudonimem "monitor"

Pierwotne zródło postu to:
http://forum.gazeta.pl/forum/72,2.html?f=32&w=84481453&a=84508135
Oraz:
http://www.sfinia.fora.pl/genezis,36/rzekome-postepy-w-abiogenezie,3510.html#64750

Problemy związane abiogenezą były już tutaj i na pl.sci.biologia wałkowane.
Powstawanie prostych, kulistych struktur tłuszczowych to obserwacja nienowa http://www.racjonalista.pl/kk.php/s,3272/q,Pierwsze.blony.komorkowe (tu moja szeroka dyskusja z Katarzyną Adamalą, która powoływała się na doświadczenia, polegajace na łaczeniu replikaz z takimi "pęcherzykami tłuszczowymi" i już wówczas - kilka latek temu próbowała udowodnić, że są to dowody na abiogenezę http://groups.google.com/group/pl.sci.biologia/browse_thread/thread/a3e8aea0fceedbad/471e7b93a8509940?lnk=gst&q=adamala+p%C4%99cherzyki+king+kong#471e7b93a8509940 Powstawanie RNA-organizmów w takich strukturach, to teoryja podważona http://creationism.org.pl/Members/admin/news/prostsze-poczatki-zycia. A więc niczego nowego nie wymodzono i jeszcze raz pokazano, że rozważania o początkach życia w ujęciu materialistycznym utknęły w martwym punkcie (ja już przestałem śledzić te abiogenetyczne konferencje). A co do prac Szostaka i jego usiłowań stworzenia sztucznej komórki z genomem minimalnym (http://groups.google.com/group/pl.sci.biologia/browse_thread/thread/f453732ff36943b/d679ea5c23146bc2?lnk=gst&q=genom+minimalny#d679ea5c23146bc2),to może kiedyś się uda stworzyć taką sztuczą komórkę, korzystając z gotowych wzorców i komponentów, ale czy będzie to dowód na abiogenezę (samoistne powstanie żywej komórki, nawet tej najprostszej z najprostszych???)???? NIE. BO TO TYLKO BĘDZIE DOWÓD NA TO, że do skonstruowania żywej komórki potrzebne jest wysokie wykształcenie, inteligencja, zaawansowana technika i pomysłowość. Czyli będzie to tylko POWTÓRZENIE INTELIGENTNEGO PROJEKTU Z ZAMIERZCHŁEJ HISTORII i nic więcej.
http://technopolis.polityka.pl/2008/sztuczne-zycie
"W październiku powrócił na łamy prasy Venter. W rozmowie z brytyjskim "The Guardian" oświadczył, że wraz z laureatem Nagrody Nobla Hamiltonem Smithem i zespołem swych 20 czołowych badaczy udało mu się skonstruować od podstaw sztuczny chromosom zawierający 381 genów (580 tys. par nukleotydów). Jest on całkowicie przekonany, że chromosom ten uda się wszczepić do żywej komórki bakteryjnej, tworząc pierwszy wyprodukowany przez człowieka żywy organizm. Będzie się nazywał Mycoplasma laboratorium i Venter wystąpił już do urzędu patentowego o ochronę swych praw autorskich."

monitor king Kong):
Jeśli taką, bliżej nie opisaną, drogą to uczynią, przestaję akceptować Inteligentny Projekt (już teraz wam zapowiadam, ze to baaaajjjeeczki, na które dajecie się łapać - Szostak musi podsycać taką wiarę, bo z tego kasiwo na badania i zycie)
http://fakty.interia.pl/newsroom/news/czlowiek-stworzy-sztuczne-zycie-za-3-lata,963123
"Jack Szostak z Harvard Medical School przewiduje, że pierwszy znaczący krok zostanie dokonany w ciagu najbliższych sześciu miesięcy. Jak twierdzi Szostak, uzyskanie sztucznej błony komórkowej, co - według Bedau jest jedną z głównych przeszkód w uzyskaniu sztucznego życia - "nie jest aż tak wielkim problemem", ponieważ naukowcy próbują wytworzyć ją przy wykorzystaniu kwasu tłuszczowego.

Kolejnym krokiem byłoby uzyskanie nukleotydów, podstawowych składników kwasów nukleinowych - czyli DNA oraz RNA. Według Szostaka, także to jest przeszkodą, którą można przeskoczyć. Resztę pracy powinna wykonać teoria Darwina: kiedy będzie już gotowa błona komórkowa, a nukleotydy będą we właściwych proporcjach, do gry wkroczy prawdopodobnie ewolucja."

monitor:
Takie i podobne badania były już przeprowadzane i ze "sztucznymi" błonami łączono gotowe replikazy (i substraty), no i ewolucja w kierunku bardziej zaawansowanego życia nie chciała zachodzić, więc bajkowe pomysły Szostaka, to tylko żerowanie na ludzkiej niewiedzy i podatnikach (dałem link, w których dyskutowałem już kilka lat temu o tych doświadczenioach z Katarzyną Adamalą i innymi na pl.sci.biologia).

A tutaj artykuł po polsku:
http://technologie.gazeta.pl/technologie/1,82008,5680675,Biolodzy_stworza_nowe_zycie_.html

"Wyniki tych prac nie zostały na razie opublikowane - ale w czasie swojego wystąpienia na International Conference on the Origin of Life we Florencji Szostak opisał, jak jego zespołowi udało się sprawić, by protokomórki zawierające informacje genetyczną zaczęły się replikować. Owo powielanie nie jest na razie w pełni autonomiczne, nie mamy więc do czynienia z prawdziwym "sztucznym życiem" - ale na pewno przybliża nas to do momentu, w którym uda się przekształcić substancje chemiczne w organizm biologiczny."

monitor:
Czy nas przybliża, zobaczymy po opublikowaniu szczegółowej analizy eksperymentu. Póki co nie ma powodu, aby mniemać, iż status tego doświadczenia jest większy niż ten, z którym dyskutowałem kilka lat temu na pl.sci.biologia. Już teraz się śmieję, a zobaczymy, jak będzie pózniej:))

O naiwni - naprawdę będę się z was śmiał, ponieważ należy dysponować ŻADNĄ wiedza na temat funkcjonowania żywej komórki,żeby uwierzyć w coś takiego.

"Dokonaliśmy znacznego postępu w kwestii tego, jak membrana protokomórki może rosnąć i dzielić się. Obecnie potrafimy skopiować pewien ograniczony zestaw prostych sekwencji genetycznych, ale chcemy nauczyć się kopiować przypadkowe sekwencje - tak, by mogły one ewoluować " - tłumaczy Jack Szostak w wywiadzie telefonicznym.

Gdy do tego dojdzie, geny te będą w stanie stworzyć nową formę życia, która rozwijać się będzie według darwinowskiej teorii, podobnie jak najstarsze żyjące organizmy na Ziemi. Czy doprowadzi to do powstania zupełnie nowej firmy życia? - tego na razie nie da się stwierdzić."

monitor:
No własnie, jeśli tak się stanie (tylko że tak nigdy się nie STANIE:)

Bajki, bajki, bajki i pożywka dla amatorów i fatnastów z bajkową wyobraznią:)

"Kiedy już stworzymy odpowiednie środowisko replikacje, mamy nadzieję eksperymentalnie sprawdzić, co może wyewoluować w tych warunkach" - mówi Sheref Mansy, były członek zespołu Szostaka, a obecnie chemik z Denver University."

monitor:
A jak się odpowiedniego środowiska nie stworzy, to się pózniej będzie gadało, że się nie wie, jakie występowało na pierwotnej Ziemi. Ale OK, niech eksperymentuja, przynajmniej będziemy mieli następny dowód na to, że abiogeneza nie zachodziła. Ale czy ich to przekona?

"race z protokomórkami reprezentują dość radykalne podejście do kwestii stworzenia sztucznego życia - nawet bardziej radykalne niż biologia syntetyczna. Even J. Craig Venter pracuje na przykład obecnie nad stworzeniem sztucznej bakterii wyposażonej w najmniejszą możliwą liczbę genów, która wystarczy do życia - w pracach tych jako szablony wykorzystywane są prawdziwe organizmy. Badacze zajmujący się protokomórkami próbuje za to zaprojektować zupełnie nową formę życia - taką, o której ludzie wcześniej nie słyszeli i która być może nigdy nie istniała."

monitor:
Ja stawiam na Ventera:)

"Szostak ma nadzieję, że uzyska w swoim laboratorium kompletny, samodzielnie replikujący się system" - komentuje Jeffrey Bada, chemik z University of California San Diego, który był współorganizatorem konferencji Origin of Life.

"Trzeba jednak pamiętać, że współczesne żyjące organizmy są o wiele bardziej złożone i skomplikowane niż proste systemy, które buduje zespół Szostaka i inni badacze. Dlatego też stworzone przez nich komórki w niczym nie będą przypominały komórek składających się na ludzki organizm czy choćby modyfikowanych przez Ventera bakterii E.Coli."

monitor:
No własnie, a jak to coś, czego istnienie przyjmiemy na wiarę, "zdechnie" po kilku sekundach i nie da początku niczemu nowemu, co jest choćby zaczątkiem nowego życia, to jak udowodnić, że kiedyś coś podobnego skutecznie w życie współczesne ewoluowało? Czy wówczas nieudany-niedokończony eksperyment Jacka Szostaka będzie w literaturze naukowej pokutował tak długo, jak pokutowały hipotezy Oparina i Świata RNA?

"Z jednej strony, mamy tu do czynienia z początkami życia, zaś z drugiej - z prostą nanomaszyną na poziomie komórkowym".

monitor:
To ,że mamy tu do czynienia z "początkiem" abiogenezy (życia), to tylko pobożne (nieudowodnione) niepoparte doświadczeniem życzenia ludzi, którzy się dorabiają manipulując wiedzą.

"Współczesne komórki wykonują to zadanie wykorzystując ogromną molekularną maszynerię. Tak naprawdę niektóre syntezy chemiczne, dokonywane przez najprostsze rośliny czy algi, są wciąż poza możliwościami człowieka i jego najnowszych technologii. Nawet najbardziej prymitywne formy życia posiadają specjalne proteinowe mechanizmy, które pozwalają im na pobieranie substancji odżywczych przez membranę komórkową czy odprowadzanie zbędnych substancji...."

monitor:
NOOOO WŁAŚNIEEEE!!!

"Powstanie takich wyspecjalizowanych komponentów wymagało wielopokoleniowej ewolucji - zwraca uwagę Ziock. Dlatego też można przyjąć, że pierwsze organizmy żywe były zdecydowanie prostsze...."

monitor:
ALE NA JAKIEJ SZCZEGÓŁOWEJ ZASADZIE PROSTSZE? jUŻ WIEMY O BAJKOWYCH ZAPEWNIENIACH EWOLUCJONISTÓW I NIE WNOSZĄCYCH NICZEGO DO NASZEJ WIEDZY :"ŻYCIE POWSTAŁO STOPNIOWO" bo jest zbyt złożone,żeby powstało od razu. No zobaczymy czy Szostak i jego załoga przeprowadzą ewolucję życia w sztucznych//symulujących dawne i prawdziwe warunkach:)

"Na czym dokładnie polegała ta prostota? Ożywiona dyskusja na ten temat trwa od wielu lat - właściwie od samego początku prac nad narodzinami życia, których pionierem był David Deamer, emerytowany profesor z UC-Santa Cruz."

monitor:
No właśnie: na czym owa prostota ma (miała) polegać?

J.D.Bernal "The Origin of Life": "Gdyby do tego zagadnienia ściśle zastosować reguły metody naukowej, w kilku miejscach tej historii można byłoby w gruncie rzeczy wykazać, jak życie powstać nie mogło - nieprawdopodobieństwo było zbyt wielkie, szansę pojawienia się życia zbyt nikłe".

monitor:
Tak było, jest i będzie. Dlatego się cieszę,że takie badania są prowadzone.

"Chemik Jeffrey Bada zwraca jednak uwagę na fakt, iż jest mało prawdopodobne, byśmy kiedykolwiek zdołali dowiedzieć się, jak zaczęło się życie. "Badania Szostaka są niezwykle ciekawe - ale wcale nie jest pewne, że to odbyło się właśnie w ten sposób" - mówi Bada."

monitor:
Chociaż żeby okazał się owy sposób alternatywnym, to już byłoby dużo, bo przynajmniej byśmy wiedzieli, że życie mogło powstać samo i ewoluować do życia współczesnego,albo innego. Czegoś takiego póki co nie dowiedziono (i nigdy się tego nie dowiedzie).

"Jack Szostak przyznaje, że mogło być inaczej - ale zastrzega, że teoria jego zespołu jest bardzo prawdopodobna. "Jesteśmy przekonani, że wzrost i podział komórek mógł nastąpić w zupełnie prawdopodobnych warunkach prebiotycznych - w sposób zupełnie naturalny, a nie tylko w sztucznym laboratoryjny środowisku" - mówi naukowiec."

minitor:
Teoria jest prawdopodobna, bo Szostak i jego załoga są PRZEKONANI. Nic dodać nic ująć. Żenada (ale oni muszą kosić kasę za te bajeczki).

edit:
A to jest najśmieszniejsze:
fakty.interia.pl/newsroom/news/czlowiek-stworzy-sztuczne-zycie-za-3-lata,963123
"Steve Benner, biochemik z Foundation for Applied Molecular
Evolution twierdzi, że otrzymanie życia to jedno, a utrzymanie go
przy życiu - drugie.

- Będziemy mieli szczęście, jeśli utrzymamy [komórki] przy życiu
przez godzinę - powiedział Benner Associated Press."

No tak zawsze można pózniej powiedzieć,że przypuszczalny
prekursor "zdechł", bo nie udało się uzyskać odpowiedniego
środowiska dla jego ewolucji I CO ZA TYM IDZIE UDOWODNIENIA,że to co
tam wymodzili mogło ewoluować w życie współczesne (lub jakiekolwiek).
Jak widać już teraz cwaniaczki się asekurują, a co za tym idzie, świat
wszystko łyknie i wszystko trafi do podręczników (taka nowa
zapchajdziura), aż przyjdzie nowy "Jack Szostak" i wszystko odnowi
nową bajeczką:)

Autor: KingKong
Data wysłania: 2008-09-12 12:37:40

Tytuł: Ważny filmik - czy Szostak da radę?
http://www.youtube.com/watch?v=3OwSARYTK7w
Tutaj można obejrzeć, w jaki sposób Jack Szostak wyobraża sobie ewolucję życia w probówce. Nic poglądowo nie zmieniło się od lat, ale będzie to dobry i ostateczny sposób, żeby wypróbować wszystkie dotychczasowe hipotezy, zwłaszcza te wyprodukowane w ostanim czasie. Jeśli ta ewolucja w laboratorium nie potwierdzi, że może wyewoluować autonomiczny replikator (życia w jakiejkolwiek postaci), a uczeni zaczną ten fakt tłumaczyć niewłaściwym środowiskiem czy tym, że to, co wymodzą, mogło jedynie przypominać protobionta (ryboorganizm), to na pohybel abiogenezie. Będzie to następne doświadczenie potwierdzające ID w kwestii powstania życia. Muszę dodać, że Szostak jest odważny i mimo wszystko to on (po Millerze) podjął się prawdziwego (a przynajmniej prawdopodobnego) doświadczenia w celu odtworzenia abiogenezy. Szkoda, że już teraz wiadomo, iż przegrał, ale jednak.

Filmik linkuje dla tych, którzy nie mają odpowiedniej wiedzy biochemicznej i nie za bardzo pojmują, o co w tym wszystkich chodzi. Mogą ponadto obejrzeć sobie inne animacje na you tube, gdzie pokazane są symulacje procesów biologicznych w prawdziwych komórkach, i wyrobić przystające do rzeczywistości zdanie.

Autor: greg
Data wysłania: 2008-12-23 13:39:42

Tytuł: inteligentny ludzki to nie to samo co boski projekt z przeszlosci
do king-kong:
napisal pan:"Czyli będzie to tylko POWTÓRZENIE INTELIGENTNEGO PROJEKTU Z ZAMIERZCHŁEJ HISTORII i nic więcej." ale to moze sugerowac, ze Daniken wraca do gry. To jednak bedzie krok naprzod - nie pierwszy przeciez i na tym chyba polega dochodzenie do znalezienia odpowiedzi na pytanie. Czyz nie? Uderza mnie, ze macie Forumowicze ogromna wiedze, a klocicie sie jak dzieci. Przeciez to nie wypada!

Autor: kk
Data wysłania: 2008-12-28 11:35:26

Tytuł: Niematerialne zycie
W czasopiśmie "Angora" ukazał się wywiad z polskim astronomem Aleksandrem Wolszczanem http://pl.wikipedia.org/wiki/Aleksander_Wolszczan pt. "Obcy są pośród nas" ('Angora' numer z 2007 r. http://www.angora.com.pl/archiwum/?y=2007&is=353&part=2 tutaj do ściagnięcia z internetu). Uczony prezentuje swoje rozważania na temat istnienia innego zycia niż te, które znamy. W końcu oświadcza w szerszych rozważaniach, że 'inne niż nasze zycie może nie być materialne i odżywiać się falami grawitacyjnymi'. Kreacjoniści od dawna twierdzą,że Bóg/Stwórca nie ma materialnego ciała, a duch, to po prostu wyższa forma zycia. Cóż za zbiezność :)

Jodkowski:
A skąd kreacjoniści mogą wiedzieć, że Bóg nie ma materialnego ciała, a duch to wyższa forma życia? Oj, chyba zebrało się Panu na żarty. Ale skoro to żarty z kreacjonistów, to niech będzie. Gorzej, gdyby Pan chciał żartować z ewolucjonistów. Tego tolerować nie będziemy.
pozdrawiam.

Autor: kk
Data wysłania: 2008-12-29 22:56:44

Tytuł: odpowiedz
>A skąd kreacjoniści mogą wiedzieć, że Bóg nie ma materialnego ciała, a duch to wyższa forma życia?

Ja, Panie Profesorze, jako kreacjonista (m.in. również przyrodniczy) przyjmuję naturę Boga tak, jak ją nakreśla Biblia. Myślę, że się wytłumaczyłem. :)

Autor: kk
Data wysłania: 2009-01-06 14:39:20

Tytuł: Do Pana Grega.
Pan wybaczy, ale nie rozumiem Pańskiego przesłania.

Data wysłania: 2012-01-20 18:01:25

Tytuł: Do KK odnośnie kulek...
Zauważam sporo błędów w Pana rozumowaniu.

"Do powstania życia potrzebnych jest tylko 20 ściśle określonych rodzajów [aminokwasów] lewoskrętnych" - niczym nieuprawnione stwierdzenie. Fakt że 20 aminokwasów klasyfikujemy jako tak zwane kanoniczne, czyli te używane w kodzie genetycznym, NIE ZNACZY że:
a) w dzisiejszych białkach występuje tylko te 20, gdyż mogą one być modyfikowane i przez to białka zyskują zmienioną funkcję;
b) kod genetyczny o którym mówimy zawsze koduje tylko 20 aminokwasów, a przykładem jest selenocysteina która choć podobna do cysteiny ma inne właściwości i występuje w kilku enzymach, a kodowana jest przez kodon UGA, który normalnie jest kodonem STOP, jednakże w przypadku gdy selen jest dostępny w środowisku oraz w mRNA obecny jest tzw. SElenoCysteine Insertion Sequence, kodon ten powoduje włączenie selenocysteiny do polipeptydu (źródło: Wikipedia); Widzimy więc, że w niektórych warunkach kod genetyczny koduje 21 aminokwasów. Drugim przykładem jest pirrolizyna.
c) nikt nie wykazał że do powstania życia potrzebnych jest dokładnie 20 aminokwasów-we wczesnych etapach wyłaniania się życia z "materii nieożywionej" (która materia jest ozywiona?) mogła być to inna liczba: mniejsza bądź większa;
d) nikt nie wykazał że muszą to być dokładnie te, które nazywamy kanonicznymi, gdyż początkowo mogły równie dobrze służyć inne, a w drodze ewolucji pre-biotycznej lub już biologicznej mogło mieć miejsce udoskonalenie kodu. Zresztą, już zostało to pokazane, że kod genetyczny który żywe organizmy używają (a po prawdzie to mamy kilka różnych, choć bardzo podobnych kodów, bo eukariotyczny różni się nieco od tego prokariotycznego) nie jest "optymalnie zaprogramowany", gdyż istnieją teoretycznie doskonalsze pod względem bezbłędnego odczytywania kody (minimalizacja mutacji, a w konsekwencji brak raka na świecie, łatwość zwalczania grypy czy HIV etc.); źródło: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2924497/. Ten który mamy, wygląda na taki w którym albo "stwórca" zaprogramował możliwość mutacji i ewolucji, albo wyewoluował jako efekt selekcji naturalnej, lub analogicznego procesu.

Podważa to zasadność logiki, której Pan używa, gdyż nie ma już konieczności wyciągnięcia dokładnie 20 czerwonych kulek w odpowiedniej kolejności (odpowiadających naszym kanonicznym aminokwasom).

Co do D-enancjomerów, mogą one tworzyć takie same białka (struktury 2-go i 3-cio rzędowe) jak L-enancjomery, tylko będące lustrzanymi odbiciami tych drugich. Umieszczenie w jednym łańcuchu polipeptydowym L- i D- aminokwasów może skutkować tym że nie powstanie żadna wyższa struktura, np. Drugorzędowa (nie można tu mówić o denaturacji, gdyż nie doszło do żadnego fałdowania w pierwszym miejscu), jeśli będą one umieszczone przypadkowo i chaotycznie, co tylko świadczy o tym, że istniała w przeszłości presja selekcyjna, aby w białkach były obecne aminokwasy tylko jednego typu, a że są to L-enenacjomery to mógł być przypadek. Gdyby było na odwrót i mielibyśmy tylko D-enancjomery w białkach, niektórzy dziwiliby sie dlaczego nie ma ich L-enancjomerów...

Ponadto, myli Pan pojęcia. DNA nie jest kodem genetycznym. Jest czasteczką chemiczną będącą nośnikiem informacji genetycznej, a kod genetyczny to sposób przyporządkowania konkretnym kodonom w DNA (czy RNA) odpowiedniego aminokwasu.

Nie słyszałem aby jakikolwiek szanowany ewolucjonista twierdził, że na początku życie posługiwało się takim samym kodem genetycznym jak dzisiaj. Co najwyżej, ostatni wspólny przodek wszystkich żyjących stworzeń na Ziemi miał kod genetyczny, który musiał być bardzo zbliżony do tego jaki obserwujemy u dzisiejszych organizmów żywych (a jak już wspomniałem znamy kilka różnych, choć bardzo podobnych kodów-patrz wyżej-i do prawdy trudno byłoby ustalić do którego dzisiejszego jest podobny najbardziej ten antyczny). Dopuszcza to możliwość, że w początkowych etapach ewolucji pre-biotycznej (świat RNA), istniały różne kody, a przetrwał ten, który okazał się najlepszy, to znaczy najlepiej służył do relatywnie wiernego kopiowania i magazynowania informacji genetycznej.

Autor: biosławek
Data wysłania: 2012-12-05 23:39:34

Tytuł: @Do p. Biotechnologa
Szanowny Panie biotechnologu,

Przepraszam, że tak długo nie odpisywałem, ale po prostu tutaj nie zaglądałem:


Biotechnolog:

„kod genetyczny o którym mówimy zawsze koduje tylko 20 aminokwasów, a przykładem jest selenocysteina która choć podobna do cysteiny ma inne właściwości i występuje w kilku enzymach, a kodowana jest przez kodon UGA, który normalnie jest kodonem STOP, jednakże w przypadku gdy selen jest dostępny w środowisku oraz w mRNA obecny jest tzw. SElenoCysteine Insertion Sequence, kodon ten powoduje włączenie selenocysteiny do polipeptydu (źródło: Wikipedia); Widzimy więc, że w niektórych warunkach kod genetyczny koduje 21 aminokwasów. Drugim przykładem jest pirrolizyna.”


Biosławek:

Stary jak węgiel i oklepany argument i już dawno wykazano, że nie ma on mocy, jaką chciałby Pan z niego czerpać. Tak naprawdę to zjawisko niesie więcej pytań niż odpowiedzi.

http://www.forum.biolog.pl/kod-genetyczny-vt21887.htm
"Jak wyjaśnić ewolucyjnie różnice w kodzie genetycznym?
Np.w grupie organizmów Ciliata (Euplotidae) kodon UGA oznacz cysteinę,a w standardowym kodon terminacyjny.Jaką wartość przystosowawczą miało przejście od jednego kodonu do drugiego w systemie kodowania informacji,skoro ,aby organizm mógł przetrwać zmiana musiała sie dokonać od razu w setkach genów? "

Popełnia Pan błąd logiczny, ponieważ dobiera Pan tendencyjnie przykłady z biologii i usiłuje nimi dowodzić to, czego one nie dowodzą. A nie dowodzą w żaden sposób faktu, że na początku swojej ewolucji protobionty mogły zawierać inne aminokwasy niż L- aminokwasy.

Biotechnolog:

niczym nieuprawnione stwierdzenie. Fakt że 20 aminokwasów klasyfikujemy jako tak zwane kanoniczne, czyli te używane w kodzie genetycznym, NIE ZNACZY że:
a) w dzisiejszych białkach występuje tylko te 20, gdyż mogą one być modyfikowane i przez to białka zyskują zmienioną funkcję.

Biosławek:

Mogą, ale jak widzimy, obserwując biologię molekularną, takie modyfikacje zdają się mieć ograniczony zakres, ponieważ w przeciwnym razie ewolucja by z takich możliwości skwapliwie korzystała.

Biotechnolog:

nikt nie wykazał że do powstania życia potrzebnych jest dokładnie 20 aminokwasów-we wczesnych etapach wyłaniania się życia z "materii nieożywionej" (która materia jest ożywiona?) mogła być to inna liczba: mniejsza bądź większa;
Biosławek:

Pozwolę sobie upiec dwie pieczenie przy jednym ogniu. Postulat, że w pierwsze organizmy mogły funkcjonować w oparciu o prostsze białka niż obecny jest oklepany i nie ma podstaw w rzeczywistości biologicznej. Natomiast znane życie minimalne nie mogło powstać przypadkowo z materii nieożywionej. Poniżej poruszę te dwa zagadnienia. Ale jeszcze to”

Biotechnolog:

„Podważa to zasadność logiki, której Pan używa, gdyż nie ma już konieczności wyciągnięcia dokładnie 20 czerwonych kulek w odpowiedniej kolejności (odpowiadających naszym kanonicznym aminokwasom).”

Biosławek:

Chce Pan przez to powiedzieć, że w bulionie pierwotnym wszystkie aminokwasy (bez względu na ich rodzaj) były właściwe i sprzyjały samoistnemu powstaniu życia i kolejność ich układana w pierwotnych białkach nie miała znaczenia? No i już chyba widać czyje myślenie z nas dwóch zahacza o logikę, a które nie. Szanowny Panie, jestem przekonany, że nie za bardzo przemyślał Pan to twierdzenie. Wiadomo bowiem, że sekwencje aminokwasów są w polipeptydach ściśle ustalone, a więc nawet, jakby białka mogły być na początku budowane z innych aminokwasów, to i tak ich sekwencje musiałyby być ściśle ustalone. A te różne aminokwasy budujące te pradawne białka musiałyby należeć do jakiegoś konkretnego i określonego biochemicznie zboru aminokwasów. Więc kiedy się weźmie pod uwagę te fakty, to problem samoistnej ewolucji życia nie znika, nawet w oparciu o Pańskie pomysły, które bardzo odbiegają od rzeczywistości biologicznej (a nawet zakładanej prebiotycznej).

Jeżeli chodzi o możliwość ewolucji (powstawania) białek u bulionie pierwotnym, to na te problemy zwrócił już uwagę Fred Hoyle:

„Wielkim problemem biologii nie jest sam oczywisty fakt, że białko to łańcuch aminokwasów połączonych ze sobą w określony sposób, lecz raczej okoliczność, że ich kolejność nadaje temu łańcuchowi szczególne właściwości (…) Gdyby aminokwasy zostały połączone przypadkowo, rezultatem byłaby ogromna liczba kombinacji nieprzydatnych żywej komórce. Kiedy się rozważy, że typowy enzym jest łańcuchem złożonym z jakichś 200 ogniw i że dla każdego ogniwa istnieje 20 możliwości, to łatwo zauważyć, iż liczba bezużytecznych kombinacji jest kolosalna, większa od liczby atomów we wszystkich galaktykach dostrzegalnych przez największe teleskopy. Tak wygląda sytuacja w wypadku jednego enzymu, a przecież jest ich przeszło 2000 i służą na ogół bardzo różnym celom. Jakim więc sposobem wszystkie one zaistniały?”

Fred Hoyle wypowiedział powyższe słowa dawno temu. Teraz wiadomo, że przeciętne białko (łańcuch polipeptydowy) w komórce składa się z 300 ogniw, to znaczy z aminokwasów lewoskrętnych. Jak wiadomo w przyrodzie istnieje jakieś 100 rodzajów aminokwasów. 50% to aminokwasy prawoskrętne i 50%, to lewoskrętne. W organizmach żywych w skład budowy białek wchodzą tylko aminokwasy lewoskrętne i w dodatku tylko 20 rodzajów z tych 50% aminokwasów lewoskrętnych. Weźmy pod uwagę oszacowanie Freda Hoyl’a. Badał on możliwość abiotycznej syntezy (samoistnego powstania życia) i założył, że pierwsze białka składały się nie nie z 300, lecz z 200 aminokwasów. Teraz wyobraźmy sobie maszynę do losowania w totolotka. Wrzućmy do niej 100 piłek (które ilustrują wszystkie rodzaje aminokwasów). 50 czerwonych (co ma ilustrować prawoskrętne aminokwasy) i 50 białych (co ma ilustrować lewoskrętne aminokwasy) z czego 20 z tych 50 białych piłek posiada namalowane numery od 1 do 20 (białe piłki z namalowanymi numerami mają obrazować te 20 z 50 rodzajów aminokwasów lewoskrętnych, które są niezbędne do powstania prawidłowych białek w żywych organizmach). Teraz zacznijmy losowanie. Jakie jest prawdopodobieństwo, że za pierwszym razem wylosujemy te 20 białych i ponumerowanych piłek w kolejności od 1 do 20?

Żeby jeszcze bardziej zbliżyć się do rzeczywistości związanej z problemem samorzutnego postania życia, musimy uszczegółowić nasz model. Pamiętajmy, że hipotetyczne, najprostsze białka w protobioncie (pierwszym żywym organizmie) Freda Hoyle’a składały się z 200 aminokwasów, nie z 20, a w naszym losowaniu mieliśmy za zadanie wylosować tylko 20 piłeczek obrazujących aminokwasy w ściśle uporządkowanej kolejności (sekwencji) od 1 do 20. Więc żeby odwzorować rzeczywistość, takie losowanie kulek, z liczbami w kolejności od 1 do 20, musiałoby się udać 10 razy z rzędu! Czy jest możliwe, aby w 10 losowaniach wylosować 10 razy pod rząd piłeczki w kolejności od 1 do 20? A pamiętajmy, że do funkcjonowania najprostszego organizmu minimalnego potrzeba przynajmniej 2000 białek złożonych, w założeniu, przynajmniej z 200 aminokwasów każde! Czyli należałoby przeprowadzić więcej takich losowań. Należałoby 2000 razy z rzędu wylosować piłeczki w kolejności od 1 do 200 ! Gołe liczby mało kogo przekonują i dopiero takie przejrzyste argumenty mogą dotrzeć do pewnych nierozsądnych umysłów, które wyćwiczyły się w akceptowaniu różnych naiwnych bajeczek, jak ta o przypadkowym powstaniu życia z takich monomerów, jak pojedyncze zasady azotowe, nukleotydy i aminokwasy.

Ewolucjoniści już dawno temu zdali sobie sprawę, że przy obecnym stanie wiedzy nie da się utrzymać na rynku idei naukowych modelu Oparina, który usiłowano podeprzeć eksperymentem Stanleya Millera. A ponieważ doszli do wniosku, że jest nieprawdopodobne, żeby gotowe białka mogły powstać w tzw. bulionie pierwotnym (hipotetycznym praoceanicznej mieszaninie aminokwasów i innych organicznych monomerów), zaproponowali więc inne hipotezy, np. ‘Świata RNA’. O tych innych hipotezach i ich nieprzystawaniu do rzeczywistości napisałem tutaj:

http://bioslawek.files.wordpress.com/2012/02/na-bezrybiu-i-rak-ryba.pdf

Tyle na temat białek, czyli proteomu (kompletnej liczby białek ) w hipotetycznym pierwszym organizmie. Pamiętajmy jednak, że białka nie biorą się znikąd i nawet, jakby powstały przypadkowo jakimś cudem, to aby taki przypadkowy organizm mógł się rozmnażać, to potrzebuje DNA i RNA (jak i takich procesów, jak replikacja DNA, transkrypcja i translacja). Jak wiemy DNA składa się z trzech zasad azotowych,bardziej szczegółowo mówiąc z nukleotydów,; A, C, G, T. Trzy zasady azotowe (tzw. kodon) kodują jeden aminokwas np.; A, C, T. A, więc żeby zakodować białko zbudowane z 200 aminokwasów potrzeba 600 nukleotydów!

Uczeni przeprowadzili eksperymenty, które miały na celu zredukowanie genomu
bakterii do jak najmniejszej liczby nukleotydów i jak się okazało takie zredukowane życie minimalne i tak jest bardzo złożone. Udało się zredukować genom pewnej bakterii do około 600 000 nukleotydów i jak dotąd nikt nie zszedł poniżej tej granicy!
Poniżej wklejam sekwencje genetyczną złożoną z 2000 nukleotydów. Taka ilość DNA może zakodować około trzech białek złożonych z 200 aminokwasów! Przy rozważaniu o początkach życia należy też pamiętać, że białka przestają być stabilne, gdy ilość tworzących je aminokwasów spada poniżej 50. Natomiast, żeby zachować przeróżne zdolności katalityczne, umożliwiające życie minimalne, przeciętna ilość cegiełek , z których zbudowane są białka, to 300 aminokwasów. To oczywiście i tak bardzo optymistyczne założenie, ponieważ niektóre białka biorące udział w replikacji DNA, transkrypcji, czy budujące rybosomy, na których odbywa się synteza białek, muszą się składać z o wiele większej liczby aminokwasów.
I nikt jeszcze nie wymyślił, jakby można było je uprościć.

Oto zapis sekwencji genetycznej, w której skład wchodzi 200 nukleotydów. Sekwencja nie jest dosłownym zapisem jakiejś sekwencji genetycznej, bo i nie ma takiej potrzeby, tylko sekwencją poglądowo – modelową, na potrzeby tutejszej dyskusji. Model ten nie ma na celu poznawania sekwencji DNA jakiegoś konkretnego organizmu, tylko ma dać pojęcie o ogromnej złożoności takich sekwencji, jak i całego genomu minimalnego.

ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGC TAC
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGT GCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT (…..)

Czy to jest duża sekwencja? Jeżeli uważacie, że tak, to pomnóżcie liczbę zasad azotowych, które ją budują przez 300. 300 x 2000 = 600 000 par zasad. , bo tyle wynosi genom minimalny!
Teraz proszę się zastanowić, w jaki sposób przypadkowo miałaby szansę powstać taka informacja, w dodatku dopasowana do możliwości zakodowania białek, które rzekomo powstały wcześniej. Tak prawdę mówiąc białka, jak i DNA oraz RNA musiałyby powstać równocześnie. Przypomina się tutaj stary dylemat; „co było wcześniej kura czy jajo?” ( DNA, RNA czy białka?). No i znowu proszę sobie wyobrazić maszynę do losowania, a w niej 600 000 białych kulek, 600 000 czerwonych kulek, 600 000 zielonych kulek i 600 000 niebieskich kulek wyobrażających cztery zasady azotowe (A, T, C i G), a następnie porządnie je wymieszać (co ma obrazować praoceaniczny racemat). Jakie jest prawdopodobieństwo, że podczas losowania wylosuje się 600 000 kulek we właściwych kolorach i we właściwej kolejności?

Sprawa jest jeszcze bardziej skomplikowana, ponieważ w hipotetycznym praoceanie musiałby powstać racemat (mieszanina) złożony z aminokwasów, nukleotydów, innych monomerów oraz całej gamy substancji nieużytecznych, podczas ewentualnej samosyntezy życia.

Biotechnolog:

„Co do D-enancjomerów, mogą one tworzyć takie same białka (struktury 2-go i 3-cio rzędowe) jak L-enancjomery, tylko będące lustrzanymi odbiciami tych drugich. Umieszczenie w jednym łańcuchu polipeptydowym L- i D- aminokwasów może skutkować tym że nie powstanie żadna wyższa struktura, np. Drugorzędowa (nie można tu mówić o denaturacji, gdyż nie doszło do żadnego fałdowania w pierwszym miejscu), jeśli będą one umieszczone przypadkowo i chaotycznie, co tylko świadczy o tym, że istniała w przeszłości presja selekcyjna, aby w białkach były obecne aminokwasy tylko jednego typu, a że są to L-enenacjomery to mógł być przypadek. Gdyby było na odwrót i mielibyśmy tylko D-enancjomery w białkach, niektórzy dziwiliby sie dlaczego nie ma ich L-enancjomerów...”

Biosławek:

O tym napisałem Panu wcześniej. Nawet jeżeli życie mogłoby być złożone z INNEGO ZBIORU AMINOKWASÓW, to musiałby to być wzór ŚCIŚLE OKREŚLONY. Takie aminokwasy musiałyby ze sobą 'współpracować' w tworzeniu odpowiednich konformacji, czy miejsc katalitycznych. To znaczy musiałyby wymuszać odpowiednie zwijanie się białek i korzystną dla komórki aktywność enzymatyczną. Tym samym sam Pan sobie strzela w kolano, ponieważ powyżej Pan poniekąd twierdzi, że nie jest bez różnicy, jakie rodzaje aminokwasów musiałyby się połączyć w bulionie pierwotnym w funkcjonalne białka. Tutaj musiałby ZADZIAŁAĆ JAKIŚ CZYNNIK selekcyjny, który mógłby wyłowić użyteczny dla powstania życia zbiór aminokwasów z racemicznej mieszaniny różnych ich typów. Pokazał Pan swoim stwierdzeniem prawdę, że losowe i niewłaściwe łączenie się różnych typów aminokwasów dawałoby ogromną ilość konfiguracji nieużytecznych. A więc moje metafory są właściwe, a słowa Freda Hoy'lea prawdziwe.

Biotechnolog:

Ponadto, myli Pan pojęcia. DNA nie jest kodem genetycznym. Jest czasteczką chemiczną będącą nośnikiem informacji genetycznej, a kod genetyczny to sposób przyporządkowania konkretnym kodonom w DNA (czy RNA) odpowiedniego aminokwasu.

Biosławek:

Dziękuję, że Pan mi to wyjaśnił, wręcz mnie Pan oświecił!


Biotechnolog:

Nie słyszałem aby jakikolwiek szanowany ewolucjonista twierdził, że na początku życie posługiwało się takim samym kodem genetycznym jak dzisiaj.

Biosławek:

A słyszał Pan co proponują w zamian?

Informator

     
  

Jeżeli chcesz otrzymywać informacje o nowościach ZGL "Nauka a Religia", napisz o tym na ten e-mail: darsag@wp.pl

  
     

Odwiedza nas 71 gości oraz 0 użytkowników.